Have questions? Visit https://www.reddit.com/r/SNPedia

rs63749024

From SNPedia

ClinVar
Risk rs63749024(-;-)
Alt rs63749024(-;-)
Reference Rs63749024(CACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG;CACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296088_153296128del41
CLNSRC
CLNACC RCV000132878.2,