Have questions? Visit https://www.reddit.com/r/SNPedia

rs61754419

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TGCCCCCACCTCCACCTGAGCCCGAGAGCTC;TGCCCCCACCTCCACCTGAGCCCGAGAGCTC) 0 common in clinvar
Make rs61754419(-;-)
Make rs61754419(-;TGCCCCCACCTCCACCTGAGCCCGAGAGCTC)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position154030641
GeneMECP2
is asnp
is mentioned by
dbSNPrs61754419
dbSNP (old)rs61754419
ClinGenrs61754419
ebirs61754419
HLIrs61754419
Exacrs61754419
Varsomers61754419
Maprs61754419
PheGenIrs61754419
Biobankrs61754419
1000 genomesrs61754419
hgdprs61754419
ensemblrs61754419
gopubmedrs61754419
geneviewrs61754419
scholarrs61754419
googlers61754419
pharmgkbrs61754419
gwascentralrs61754419
openSNPrs61754419
23andMers61754419
23andMe allrs61754419
SNP Nexus

SNPshotrs61754419
SNPdbers61754419
MSV3drs61754419
GWAS Ctlgrs61754419
Max Magnitude0
ClinVar
Risk rs61754419(-;-)
Alt rs61754419(-;-)
Reference Rs61754419(TGCCCCCACCTCCACCTGAGCCCGAGAGCTC;TGCCCCCACCTCCACCTGAGCCCGAGAGCTC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296092_153296122del31
CLNSRC
CLNACC RCV000132891.2,