Have questions? Visit https://www.reddit.com/r/SNPedia

rs61752992

From SNPedia

ClinVar
Risk Rs61752992(ACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC;ACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC) rs61752992(-;-)
Alt Rs61752992(ACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC;ACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC) rs61752992(-;-)
Reference rs61752992(GCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCA;GCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCA)
Significance Pathogenic
Disease not provided not specified Autism Severe neonatal-onset encephalopathy with microcephaly Mental retardation Rett syndrome Delayed gross motor development Delayed speech and language development Loss of ability to walk Angelman syndrome Smith-Magenis Syndrome-like
Variation info
Gene MECP2
CLNDBN not provided not specified Autism, susceptibility to, X-linked 3 Severe neonatal-onset encephalopathy with microcephaly Mental retardation, X-linked, syndromic 13 Rett syndrome Delayed gross motor development Delayed speech and language development Loss of ability to walk Angelman syndrome Smith-Magenis Syndrome-like
Reversed 1
HGVS NC_000023.10:g.153296072_153296115del44
CLNSRC Children's Hospital of Eastern Ontario
CLNACC RCV000132932.6, RCV000168704.2, RCV000169931.1, RCV000169932.1, RCV000170102.1, RCV000170103.4, RCV000415090.1, RCV000461051.1, RCV000491803.1,