Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231372

From SNPedia

ClinVar
Risk rs606231372(-;-)
Alt rs606231372(-;-)
Reference Rs606231372(GGTCCAGATGGATTGCAAGGTCCCCCA;GGTCCAGATGGATTGCAAGGTCCCCCA)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107930739_107930765del27
CLNSRC
CLNACC RCV000021609.1,