Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231365

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs606231365(-;AAAATTCAAACTTCAGAAAT)
Make rs606231365(AAAATTCAAACTTCAGAAAT;AAAATTCAAACTTCAGAAAT)
ReferenceGRCh38.p2 38.2/144
Chromosome10
Position89014429
GeneFAS
is asnp
is mentioned by
dbSNPrs606231365
dbSNP (old)rs606231365
ClinGenrs606231365
ebirs606231365
HLIrs606231365
Exacrs606231365
Gnomadrs606231365
Varsomers606231365
Maprs606231365
PheGenIrs606231365
Biobankrs606231365
1000 genomesrs606231365
hgdprs606231365
ensemblrs606231365
gopubmedrs606231365
geneviewrs606231365
scholarrs606231365
googlers606231365
pharmgkbrs606231365
gwascentralrs606231365
openSNPrs606231365
23andMers606231365
23andMe allrs606231365
SNP Nexus

SNPshotrs606231365
SNPdbers606231365
MSV3drs606231365
GWAS Ctlgrs606231365
Max Magnitude0
ClinVar
Risk rs606231365(AAAATTCAAACTTCAGAAAT;AAAATTCAAACTTCAGAAAT)
Alt rs606231365(AAAATTCAAACTTCAGAAAT;AAAATTCAAACTTCAGAAAT)
Reference Rs606231365(-;-)
Significance Pathogenic
Disease Autoimmune lymphoproliferative syndrome
Variation info
Gene FAS
CLNDBN Autoimmune lymphoproliferative syndrome, type 1a
Reversed 0
HGVS NC_000010.10:g.90774167_90774186dup20
CLNSRC OMIM Allelic Variant
CLNACC RCV000017973.30,