Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231192

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
(T;T) 0 common in clinvar
Make rs606231192(-;AGTCAATGAAAT)
Make rs606231192(AGTCAATGAAAT;AGTCAATGAAAT)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position19359743
GeneMAP3K15, PDHA1
is asnp
is mentioned by
dbSNPrs606231192
dbSNP (old)rs606231192
ClinGenrs606231192
ebirs606231192
HLIrs606231192
Exacrs606231192
Varsomers606231192
Maprs606231192
PheGenIrs606231192
Biobankrs606231192
1000 genomesrs606231192
hgdprs606231192
ensemblrs606231192
gopubmedrs606231192
geneviewrs606231192
scholarrs606231192
googlers606231192
pharmgkbrs606231192
gwascentralrs606231192
openSNPrs606231192
23andMers606231192
23andMe allrs606231192
SNP Nexus

SNPshotrs606231192
SNPdbers606231192
MSV3drs606231192
GWAS Ctlgrs606231192
Max Magnitude0
ClinVar
Risk rs606231192(AGTCAATGAAAT;AGTCAATGAAAT) rs606231192(TCAATGAAATTCTTGGAAAC;TCAATGAAATTCTTGGAAAC)
Alt rs606231192(AGTCAATGAAAT;AGTCAATGAAAT) rs606231192(TCAATGAAATTCTTGGAAAC;TCAATGAAATTCTTGGAAAC)
Reference Rs606231192(-;-)
Significance Pathogenic
Disease Pyruvate dehydrogenase E1-alpha deficiency
Variation info
Gene PDHA1 MAP3K15
CLNDBN Pyruvate dehydrogenase E1-alpha deficiency
Reversed 0
HGVS NC_000023.10:g.19377850_19377861dupAGTCAATGAAAT
CLNSRC OMIM Allelic Variant
CLNACC RCV000011638.8,