Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231188

From SNPedia

ClinVar
Risk rs606231188(ATAGTTACCGTACACGAGAAG;ATAGTTACCGTACACGAGAAG)
Alt rs606231188(ATAGTTACCGTACACGAGAAG;ATAGTTACCGTACACGAGAAG)
Reference Rs606231188(;)
Significance Pathogenic
Disease Pyruvate dehydrogenase E1-alpha deficiency
Variation info
Gene PDHA1
CLNDBN Pyruvate dehydrogenase E1-alpha deficiency
Reversed 0
HGVS NC_000023.10:g.19377031_19377051dup21
CLNSRC OMIM Allelic Variant
CLNACC RCV000011624.10,