Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231188

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs606231188(-;TAGTTACCGTACACGAGAAGA)
Make rs606231188(TAGTTACCGTACACGAGAAGA;TAGTTACCGTACACGAGAAGA)
ReferenceGRCh38.p2 38.2/147
ChromosomeX
Position19358933
GenePDHA1
is asnp
is mentioned by
dbSNPrs606231188
dbSNP (old)rs606231188
ClinGenrs606231188
ebirs606231188
HLIrs606231188
Exacrs606231188
Varsomers606231188
Maprs606231188
PheGenIrs606231188
Biobankrs606231188
1000 genomesrs606231188
hgdprs606231188
ensemblrs606231188
gopubmedrs606231188
geneviewrs606231188
scholarrs606231188
googlers606231188
pharmgkbrs606231188
gwascentralrs606231188
openSNPrs606231188
23andMers606231188
23andMe allrs606231188
SNP Nexus

SNPshotrs606231188
SNPdbers606231188
MSV3drs606231188
GWAS Ctlgrs606231188
Max Magnitude0
ClinVar
Risk rs606231188(ATAGTTACCGTACACGAGAAG;ATAGTTACCGTACACGAGAAG)
Alt rs606231188(ATAGTTACCGTACACGAGAAG;ATAGTTACCGTACACGAGAAG)
Reference Rs606231188(-;-)
Significance Pathogenic
Disease Pyruvate dehydrogenase E1-alpha deficiency
Variation info
Gene PDHA1
CLNDBN Pyruvate dehydrogenase E1-alpha deficiency
Reversed 0
HGVS NC_000023.10:g.19377031_19377051dup21
CLNSRC OMIM Allelic Variant
CLNACC RCV000011624.10,