Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Malignant melanoma predisposing mutation
Is agenotype
Merged intoRs587780668
Geno Mag Summary
(-;-) 0 common/normal
(-;GGCGGCGGGGAGCAGCATGGAGCC) 5 Malignant melanoma predisposing mutation

see rs606231175