Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231174

From SNPedia

ClinVar
Risk rs606231174(GCGGCGGCGGCTGCGGCGGCGGCGGCGGCT;GCGGCGGCGGCTGCGGCGGCGGCGGCGGCT)
Alt rs606231174(GCGGCGGCGGCTGCGGCGGCGGCGGCGGCT;GCGGCGGCGGCTGCGGCGGCGGCGGCGGCT)
Reference Rs606231174(-;-)
Significance Pathogenic
Disease Cleidocranial dysplasia
Variation info
Gene RUNX2
CLNDBN Cleidocranial dysplasia, forme fruste, with brachydactyly
Reversed 0
HGVS NC_000006.11:g.45390494_45390523dup30
CLNSRC OMIM Allelic Variant
CLNACC RCV000009880.4,