Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231172

From SNPedia

ClinVar
Risk rs606231172(ACGCCGGTCACGTGGCGGGGTGGGG;ACGCCGGTCACGTGGCGGGGTGGGG)
Alt rs606231172(ACGCCGGTCACGTGGCGGGGTGGGG;ACGCCGGTCACGTGGCGGGGTGGGG)
Reference Rs606231172(-;-)
Significance Pathogenic
Disease Exercise-induced hyperinsulinemic hypoglycemia
Variation info
Gene SLC16A1 SLC16A1-AS1
CLNDBN Exercise-induced hyperinsulinemic hypoglycemia
Reversed 1
HGVS NC_000001.10:g.113499002_113499003insCCCCACCCCGCCACGTGACCGGCGT
CLNSRC OMIM Allelic Variant
CLNACC RCV000009472.3,