Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231139(TTG;TTG)

From SNPedia
(Redirected from Rs606231139(CTTG;CTTG))

Coenzyme Q10 Deficiency; severity varies
Is agenotype
ofrs606231139
GeneADCK3, COQ8A
Chromosome1
Position226,965,322
mentionedby
Magnitude5.6
ReputeBad
Geno Mag Summary
(AATCCCCTGTTGGGGGCCTCAC;AATCCCCTGTTGGGGGCCTCAC) 0 common in clinvar
(AATCCCCTGTTGGGGGCCTCAC;TTG) 3 Carrier of a coenzyme Q10 deficiency mutation
(TTG;TTG) 5.6 Coenzyme Q10 Deficiency; severity varies

see coenzyme Q10 deficiency