Have questions? Visit https://www.reddit.com/r/SNPedia

rs587782540

From SNPedia

Merged intors587780124
Orientationplus
Stabilizedplus
Geno Mag Summary
(GCAGCAGGCGGCTACTGCACAAGCT;GCAGCAGGCGGCTACTGCACAAGCT) 0 common in clinvar
Make rs587782540(-;-)
Make rs587782540(-;GCAGCAGGCGGCTACTGCACAAGCT)
ReferenceGRCh38.p2 38.2/144
Chromosome18
Position51076673
GeneSMAD4
is asnp
is mentioned by
dbSNPrs587782540
dbSNP (old)rs587782540
ClinGenrs587782540
ebirs587782540
HLIrs587782540
Exacrs587782540
Gnomadrs587782540
Varsomers587782540
Maprs587782540
PheGenIrs587782540
Biobankrs587782540
1000 genomesrs587782540
hgdprs587782540
ensemblrs587782540
gopubmedrs587782540
geneviewrs587782540
scholarrs587782540
googlers587782540
pharmgkbrs587782540
gwascentralrs587782540
openSNPrs587782540
23andMers587782540
23andMe allrs587782540
SNP Nexus

SNPshotrs587782540
SNPdbers587782540
MSV3drs587782540
GWAS Ctlgrs587782540
StatusMerged into rs587780124
Max Magnitude0
ClinVar
Risk
Alt
Reference Rs587782540(GCAGCAGGCGGCTACTGCACAAGCT;GCAGCAGGCGGCTACTGCACAAGCT)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome not provided
Variation info
Gene SMAD4
CLNDBN Hereditary cancer-predisposing syndrome not provided
Reversed 0
HGVS NC_000018.9:g.48603050_48603074del25
CLNSRC
CLNACC RCV000115881.4, RCV000235213.1,