Have questions? Visit https://www.reddit.com/r/SNPedia

rs587781526

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TCTATGATCTCTTTAGGGGT;TCTATGATCTCTTTAGGGGT) 0 common in clinvar
Make rs587781526(AATA;AATA)
Make rs587781526(AATA;TCTATGATCTCTTTAGGGGT)
ReferenceGRCh38.p2 38.2/144
Chromosome17
Position43063370
GeneBRCA1
is asnp
is mentioned by
dbSNPrs587781526
dbSNP (old)rs587781526
ClinGenrs587781526
ebirs587781526
HLIrs587781526
Exacrs587781526
Gnomadrs587781526
Varsomers587781526
Maprs587781526
PheGenIrs587781526
Biobankrs587781526
1000 genomesrs587781526
hgdprs587781526
ensemblrs587781526
gopubmedrs587781526
geneviewrs587781526
scholarrs587781526
googlers587781526
pharmgkbrs587781526
gwascentralrs587781526
openSNPrs587781526
23andMers587781526
23andMe allrs587781526
SNP Nexus

SNPshotrs587781526
SNPdbers587781526
MSV3drs587781526
GWAS Ctlgrs587781526
Max Magnitude0
ClinVar
Risk rs587781526(AATA;AATA)
Alt rs587781526(AATA;AATA)
Reference Rs587781526(TCTATGATCTCTTTAGGGGT;TCTATGATCTCTTTAGGGGT)
Significance Probable-Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene BRCA1
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.41215387_41215406del20insTATT
CLNSRC
CLNACC RCV000129518.1,