Have questions? Visit https://www.reddit.com/r/SNPedia

rs587781240

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs587781240(-;CTCAAGCAAAGAAAAACTTAA)
Make rs587781240(CTCAAGCAAAGAAAAACTTAA;CTCAAGCAAAGAAAAACTTAA)
ReferenceGRCh38.p2 38.2/144
Chromosome15
Position25339188
GeneUBE3A
is asnp
is mentioned by
dbSNPrs587781240
dbSNP (old)rs587781240
ClinGenrs587781240
ebirs587781240
HLIrs587781240
Exacrs587781240
Gnomadrs587781240
Varsomers587781240
Maprs587781240
PheGenIrs587781240
Biobankrs587781240
1000 genomesrs587781240
hgdprs587781240
ensemblrs587781240
gopubmedrs587781240
geneviewrs587781240
scholarrs587781240
googlers587781240
pharmgkbrs587781240
gwascentralrs587781240
openSNPrs587781240
23andMers587781240
23andMe allrs587781240
SNP Nexus

SNPshotrs587781240
SNPdbers587781240
MSV3drs587781240
GWAS Ctlgrs587781240
Max Magnitude0
ClinVar
Risk rs587781240(CTCAAGCAAAGAAAAACTTAA;CTCAAGCAAAGAAAAACTTAA) rs587781240(CTTAA;CTTAA)
Alt rs587781240(CTCAAGCAAAGAAAAACTTAA;CTCAAGCAAAGAAAAACTTAA) rs587781240(CTTAA;CTTAA)
Reference Rs587781240(-;-)
Significance Pathogenic
Disease Angelman syndrome
Variation info
Gene UBE3A
CLNDBN Angelman syndrome
Reversed 1
HGVS NC_000015.9:g.25584336_25584340dupTTAAG; NC_000015.9:g.25584336_25584356dup21
CLNSRC
CLNACC RCV000193223.1, RCV000144316.1,