Have questions? Visit https://www.reddit.com/r/SNPedia

rs587781230

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs587781230(-;CTTA)
Make rs587781230(CTTA;CTTA)
ReferenceGRCh38.p2 38.2/144
Chromosome15
Position25339189
GeneUBE3A
is asnp
is mentioned by
dbSNPrs587781230
dbSNP (old)rs587781230
ClinGenrs587781230
ebirs587781230
HLIrs587781230
Exacrs587781230
Gnomadrs587781230
Varsomers587781230
Maprs587781230
PheGenIrs587781230
Biobankrs587781230
1000 genomesrs587781230
hgdprs587781230
ensemblrs587781230
gopubmedrs587781230
geneviewrs587781230
scholarrs587781230
googlers587781230
pharmgkbrs587781230
gwascentralrs587781230
openSNPrs587781230
23andMers587781230
23andMe allrs587781230
SNP Nexus

SNPshotrs587781230
SNPdbers587781230
MSV3drs587781230
GWAS Ctlgrs587781230
Max Magnitude0
ClinVar
Risk rs587781230(TAATGTGCTTTTACTTCCGGAATACTCAAGCAAAGAAAAACTTA;TAATGTGCTTTTACTTCCGGAATACTCAAGCAAAGAAAAACTTA) rs587781230(CTTA;CTTA)
Alt rs587781230(TAATGTGCTTTTACTTCCGGAATACTCAAGCAAAGAAAAACTTA;TAATGTGCTTTTACTTCCGGAATACTCAAGCAAAGAAAAACTTA) rs587781230(CTTA;CTTA)
Reference Rs587781230(-;-)
Significance Pathogenic
Disease Angelman syndrome
Variation info
Gene UBE3A
CLNDBN Angelman syndrome
Reversed 1
HGVS NC_000015.9:g.25584337_25584340dupTAAG; NC_000015.9:g.25584337_25584380dup44
CLNSRC
CLNACC RCV000144306.1, RCV000194169.1,