Have questions? Visit https://www.reddit.com/r/SNPedia

rs587778905

From SNPedia

ClinVar
Risk rs587778905(TAAA;TAAA)
Alt rs587778905(TAAA;TAAA)
Reference Rs587778905(GGATACAACAAAGGGGACTTC;GGATACAACAAAGGGGACTTC)
Significance Pathogenic
Disease Lynch syndrome
Variation info
Gene MLH1
CLNDBN Lynch syndrome
Reversed 0
HGVS NC_000003.11:g.37067436_37067456del21insTAAA
CLNSRC International Society for Gastrointestinal Hereditary Tumours
CLNACC RCV000075176.2,