Have questions? Visit https://www.reddit.com/r/SNPedia

rs587778449

From SNPedia

ClinVar
Risk rs587778449(-;-)
Alt rs587778449(-;-)
Reference Rs587778449(GCACCTGTCCCCCCGGCCTGAGGAGCC;GCACCTGTCCCCCCGGCCTGAGGAGCC)
Significance Probable-Pathogenic
Disease not specified Kabuki syndrome 1 not provided
Variation info
Gene KMT2D
CLNDBN not specified Kabuki syndrome 1 not provided
Reversed 1
HGVS NC_000012.11:g.49445190_49445216delGGCTCCTCAGGCCGGGGGGACAGGTGC
CLNSRC
CLNACC RCV000121368.2, RCV000146194.1, RCV000429353.1,