Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776869

From SNPedia
ClinVar
Risk rs587776869(GCGGCGGCCGCGGCCGCGGCTGCCGCG;GCGGCGGCCGCGGCCGCGGCTGCCGCG) rs587776869(GCGGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT;GCGGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT)
Alt rs587776869(GCGGCGGCCGCGGCCGCGGCTGCCGCG;GCGGCGGCCGCGGCCGCGGCTGCCGCG) rs587776869(GCGGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT;GCGGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT)
Reference Rs587776869(-;-)
Significance Pathogenic
Disease Epileptic encephalopathy Lissencephaly 2
Variation info
Gene ARX
CLNDBN Epileptic encephalopathy, early infantile, 1 Lissencephaly 2, X-linked
Reversed 0
HGVS NC_000023.10:g.25031651_25031677dup27; NC_000023.10:g.25031651_25031686dup36
CLNSRC OMIM Allelic Variant
CLNACC RCV000022855.6, RCV000193636.1,