Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776711

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(GCGTCGTCCCCTCGGCTGACCTC;GCGTCGTCCCCTCGGCTGACCTC) 0 common in clinvar
Make rs587776711(-;-)
Make rs587776711(-;GCGTCGTCCCCTCGGCTGACCTC)
ReferenceGRCh38 38.1/142
Chromosome9
Position136199658
GeneLHX3
is asnp
is mentioned by
dbSNPrs587776711
dbSNP (old)rs587776711
ClinGenrs587776711
ebirs587776711
HLIrs587776711
Exacrs587776711
Gnomadrs587776711
Varsomers587776711
Maprs587776711
PheGenIrs587776711
Biobankrs587776711
1000 genomesrs587776711
hgdprs587776711
ensemblrs587776711
gopubmedrs587776711
geneviewrs587776711
scholarrs587776711
googlers587776711
pharmgkbrs587776711
gwascentralrs587776711
openSNPrs587776711
23andMers587776711
23andMe allrs587776711
SNP Nexus

SNPshotrs587776711
SNPdbers587776711
MSV3drs587776711
GWAS Ctlgrs587776711
Max Magnitude0
ClinVar
Risk rs587776711(-;-)
Alt rs587776711(-;-)
Reference Rs587776711(GCGTCGTCCCCTCGGCTGACCTC;GCGTCGTCCCCTCGGCTGACCTC)
Significance Pathogenic
Disease Pituitary hormone deficiency
Variation info
Gene LHX3
CLNDBN Pituitary hormone deficiency, combined 3
Reversed 0
HGVS NC_000009.11:g.139091504_139091526del23
CLNSRC OMIM Allelic Variant
CLNACC RCV000009588.5,