Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776627

From SNPedia

ClinVar
Risk Rs587776627(GGGAATGTGAGGTAGGGGCACCCGCCCATTGA;GGGAATGTGAGGTAGGGGCACCCGCCCATTGA) rs587776627(-;-)
Alt Rs587776627(GGGAATGTGAGGTAGGGGCACCCGCCCATTGA;GGGAATGTGAGGTAGGGGCACCCGCCCATTGA) rs587776627(-;-)
Reference Rs587776627(TCAATGGGCGGGTGCCCCTACCTCACATTCCC;TCAATGGGCGGGTGCCCCTACCTCACATTCCC)
Significance Pathogenic
Disease Hepatocellular carcinoma
Variation info
Gene AXIN1
CLNDBN Hepatocellular carcinoma
Reversed 1
HGVS NC_000016.9:g.359973_360004del32
CLNSRC OMIM Allelic Variant
CLNACC RCV000006408.4,