Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776535

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(GGCGCGGGGATCTAGGACGCCG;GGCGCGGGGATCTAGGACGCCG) 0 common in clinvar
Make rs587776535(-;-)
Make rs587776535(-;GGCGCGGGGATCTAGGACGCCG)
ReferenceGRCh38 38.1/142
Chromosome2
Position70790603
GeneFIGLA
is asnp
is mentioned by
dbSNPrs587776535
dbSNP (old)rs587776535
ClinGenrs587776535
ebirs587776535
HLIrs587776535
Exacrs587776535
Gnomadrs587776535
Varsomers587776535
Maprs587776535
PheGenIrs587776535
Biobankrs587776535
1000 genomesrs587776535
hgdprs587776535
ensemblrs587776535
gopubmedrs587776535
geneviewrs587776535
scholarrs587776535
googlers587776535
pharmgkbrs587776535
gwascentralrs587776535
openSNPrs587776535
23andMers587776535
23andMe allrs587776535
SNP Nexus

SNPshotrs587776535
SNPdbers587776535
MSV3drs587776535
GWAS Ctlgrs587776535
Max Magnitude0
ClinVar
Risk
Alt
Reference Rs587776535(GGCGCGGGGATCTAGGACGCCG;GGCGCGGGGATCTAGGACGCCG)
Significance Pathogenic
Disease Premature ovarian failure 6
Variation info
Gene FIGLA
CLNDBN Premature ovarian failure 6
Reversed 0
HGVS NC_000002.12:g.70790603_70790624del22
CLNSRC OMIM Allelic Variant
CLNACC RCV000002219.2,