Have questions? Visit https://www.reddit.com/r/SNPedia

rs515726173

From SNPedia

ClinVar
Risk rs515726173(T;T)
Alt rs515726173(T;T)
Reference Rs515726173(GAACCCTGCAAAAAGTGACACTATC;GAACCCTGCAAAAAGTGACACTATC)
Significance Pathogenic
Disease not specified Carnitine palmitoyltransferase II deficiency not provided
Variation info
Gene CPT2
CLNDBN not specified Carnitine palmitoyltransferase II deficiency not provided
Reversed 0
HGVS NC_000001.10:g.53675880_53675904del25insT
CLNSRC
CLNACC RCV000178039.1, RCV000202494.1, RCV000414700.1,