Have questions? Visit https://www.reddit.com/r/SNPedia

rs398123693

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(AACTCCACCGCGGCGGCGGC;AACTCCACCGCGGCGGCGGC) 0 common in clinvar
(GCGGCGGCGGCAACTCCACC;GCGGCGGCGGCAACTCCACC) 0 common in clinvar
Make rs398123693(-;-)
Make rs398123693(-;AACTCCACCGCGGCGGCGGC)
ReferenceGRCh38 38.1/141
Chromosome3
Position181712430
GeneSOX2, SOX2-OT
is asnp
is mentioned by
dbSNPrs398123693
dbSNP (old)rs398123693
ClinGenrs398123693
ebirs398123693
HLIrs398123693
Exacrs398123693
Varsomers398123693
Maprs398123693
PheGenIrs398123693
Biobankrs398123693
1000 genomesrs398123693
hgdprs398123693
ensemblrs398123693
gopubmedrs398123693
geneviewrs398123693
scholarrs398123693
googlers398123693
pharmgkbrs398123693
gwascentralrs398123693
openSNPrs398123693
23andMers398123693
23andMe allrs398123693
SNP Nexus

SNPshotrs398123693
SNPdbers398123693
MSV3drs398123693
GWAS Ctlgrs398123693
Max Magnitude0
ClinVar
Risk rs398123693(-;-)
Alt rs398123693(-;-)
Reference Rs398123693(GCGGCGGCGGCAACTCCACC;GCGGCGGCGGCAACTCCACC)
Significance Pathogenic
Disease not provided Microphthalmia syndromic 3
Variation info
Gene SOX2-OT SOX2
CLNDBN not provided Microphthalmia syndromic 3
Reversed 0
HGVS NC_000003.11:g.181430218_181430237del20
CLNSRC HGMD
CLNACC RCV000080064.4, RCV000359617.1,