Have questions? Visit https://www.reddit.com/r/SNPedia

rs398122832

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(AGATCAATGGCTACCCCAAA;AGATCAATGGCTACCCCAAA) 0 common in clinvar
Make rs398122832(-;-)
Make rs398122832(-;AGATCAATGGCTACCCCAAA)
ReferenceGRCh38 38.1/141
Chromosome15
Position48412620
GeneFBN1
is asnp
is mentioned by
dbSNPrs398122832
dbSNP (old)rs398122832
ClinGenrs398122832
ebirs398122832
HLIrs398122832
Exacrs398122832
Varsomers398122832
Maprs398122832
PheGenIrs398122832
Biobankrs398122832
1000 genomesrs398122832
hgdprs398122832
ensemblrs398122832
gopubmedrs398122832
geneviewrs398122832
scholarrs398122832
googlers398122832
pharmgkbrs398122832
gwascentralrs398122832
openSNPrs398122832
23andMers398122832
23andMe allrs398122832
SNP Nexus

SNPshotrs398122832
SNPdbers398122832
MSV3drs398122832
GWAS Ctlgrs398122832
Max Magnitude0
ClinVar
Risk rs398122832(-;-)
Alt rs398122832(-;-)
Reference Rs398122832(AGATCAATGGCTACCCCAAA;AGATCAATGGCTACCCCAAA)
Significance Pathogenic
Disease Marfan lipodystrophy syndrome
Variation info
Gene FBN1
CLNDBN Marfan lipodystrophy syndrome
Reversed 1
HGVS NC_000015.9:g.48704817_48704836del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000033242.29,