Have questions? Visit https://www.reddit.com/r/SNPedia

rs397518444

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs397518444(-;AGCTCAGCGTAGACCTCCGCGCC)
Make rs397518444(AGCTCAGCGTAGACCTCCGCGCC;AGCTCAGCGTAGACCTCCGCGCC)
ReferenceGRCh38 38.1/141
Chromosome19
Position2251693
GeneAMH
is asnp
is mentioned by
dbSNPrs397518444
dbSNP (old)rs397518444
ClinGenrs397518444
ebirs397518444
HLIrs397518444
Exacrs397518444
Gnomadrs397518444
Varsomers397518444
Maprs397518444
PheGenIrs397518444
Biobankrs397518444
1000 genomesrs397518444
hgdprs397518444
ensemblrs397518444
gopubmedrs397518444
geneviewrs397518444
scholarrs397518444
googlers397518444
pharmgkbrs397518444
gwascentralrs397518444
openSNPrs397518444
23andMers397518444
23andMe allrs397518444
SNP Nexus

SNPshotrs397518444
SNPdbers397518444
MSV3drs397518444
GWAS Ctlgrs397518444
Max Magnitude0
ClinVar
Risk rs397518444(AGCTCAGCGTAGACCTCCGCGCC;AGCTCAGCGTAGACCTCCGCGCC)
Alt rs397518444(AGCTCAGCGTAGACCTCCGCGCC;AGCTCAGCGTAGACCTCCGCGCC)
Reference Rs397518444(-;-)
Significance Pathogenic
Disease Persistent mullerian duct syndrome
Variation info
Gene AMH
CLNDBN Persistent mullerian duct syndrome, type I
Reversed 0
HGVS NC_000019.9:g.2251670_2251692dup23
CLNSRC OMIM Allelic Variant
CLNACC RCV000009157.3,