Have questions? Visit https://www.reddit.com/r/SNPedia

rs397515375

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GCCTGCTGCTCACCGCCGCGC;GCCTGCTGCTCACCGCCGCGC) 0 common in clinvar
Make rs397515375(-;-)
Make rs397515375(-;GCCTGCTGCTCACCGCCGCGC)
ReferenceGRCh38 38.1/141
Chromosome7
Position155803481
GeneSHH
is asnp
is mentioned by
dbSNPrs397515375
dbSNP (old)rs397515375
ClinGenrs397515375
ebirs397515375
HLIrs397515375
Exacrs397515375
Varsomers397515375
Maprs397515375
PheGenIrs397515375
Biobankrs397515375
1000 genomesrs397515375
hgdprs397515375
ensemblrs397515375
gopubmedrs397515375
geneviewrs397515375
scholarrs397515375
googlers397515375
pharmgkbrs397515375
gwascentralrs397515375
openSNPrs397515375
23andMers397515375
23andMe allrs397515375
SNP Nexus

SNPshotrs397515375
SNPdbers397515375
MSV3drs397515375
GWAS Ctlgrs397515375
Max Magnitude0
ClinVar
Risk rs397515375(-;-)
Alt rs397515375(-;-)
Reference Rs397515375(GCCTGCTGCTCACCGCCGCGC;GCCTGCTGCTCACCGCCGCGC)
Significance Pathogenic
Disease Holoprosencephaly 3
Variation info
Gene SHH
CLNDBN Holoprosencephaly 3
Reversed 1
HGVS NC_000007.13:g.155596175_155596195del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000009434.3,