Have questions? Visit https://www.reddit.com/r/SNPedia

rs397515345

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TCGGACGAGGACAGCGTCTC;TCGGACGAGGACAGCGTCTC) 0 common in clinvar
Make rs397515345(-;-)
Make rs397515345(-;TCGGACGAGGACAGCGTCTC)
ReferenceGRCh38 38.1/141
Chromosome17
Position74919985
GeneUSH1G
is asnp
is mentioned by
dbSNPrs397515345
dbSNP (old)rs397515345
ClinGenrs397515345
ebirs397515345
HLIrs397515345
Exacrs397515345
Gnomadrs397515345
Varsomers397515345
Maprs397515345
PheGenIrs397515345
Biobankrs397515345
1000 genomesrs397515345
hgdprs397515345
ensemblrs397515345
gopubmedrs397515345
geneviewrs397515345
scholarrs397515345
googlers397515345
pharmgkbrs397515345
gwascentralrs397515345
openSNPrs397515345
23andMers397515345
23andMe allrs397515345
SNP Nexus

SNPshotrs397515345
SNPdbers397515345
MSV3drs397515345
GWAS Ctlgrs397515345
Max Magnitude0
ClinVar
Risk rs397515345(-;-)
Alt rs397515345(-;-)
Reference Rs397515345(TCGGACGAGGACAGCGTCTC;TCGGACGAGGACAGCGTCTC)
Significance Pathogenic
Disease Usher syndrome Usher syndrome
Variation info
Gene USH1G
CLNDBN Usher syndrome, type 1G Usher syndrome, type 1
Reversed 1
HGVS NC_000017.10:g.72916080_72916099del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000003050.5, RCV000216021.1,