Have questions? Visit https://www.reddit.com/r/SNPedia

rs397514254

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs397514254(-;GAGGTGCAGGCCATGCTCGGC)
Make rs397514254(GAGGTGCAGGCCATGCTCGGC;GAGGTGCAGGCCATGCTCGGC)
ReferenceGRCh38 38.1/141
Chromosome19
Position44908731
GeneAPOE
is asnp
is mentioned by
dbSNPrs397514254
dbSNP (old)rs397514254
ClinGenrs397514254
ebirs397514254
HLIrs397514254
Exacrs397514254
Gnomadrs397514254
Varsomers397514254
Maprs397514254
PheGenIrs397514254
Biobankrs397514254
1000 genomesrs397514254
hgdprs397514254
ensemblrs397514254
gopubmedrs397514254
geneviewrs397514254
scholarrs397514254
googlers397514254
pharmgkbrs397514254
gwascentralrs397514254
openSNPrs397514254
23andMers397514254
23andMe allrs397514254
SNP Nexus

SNPshotrs397514254
SNPdbers397514254
MSV3drs397514254
GWAS Ctlgrs397514254
Max Magnitude0
ClinVar
Risk rs397514254(CGGCGAGGTGCAGGCCATGCT;CGGCGAGGTGCAGGCCATGCT)
Alt rs397514254(CGGCGAGGTGCAGGCCATGCT;CGGCGAGGTGCAGGCCATGCT)
Reference Rs397514254(-;-)
Significance Pathogenic
Disease Familial type 3 hyperlipoproteinemia
Variation info
Gene APOE
CLNDBN Familial type 3 hyperlipoproteinemia
Reversed 0
HGVS NC_000019.9:g.45411968_45411988dup21
CLNSRC OMIM Allelic Variant
CLNACC RCV000019434.28,