Have questions? Visit https://www.reddit.com/r/SNPedia

rs397509302

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs397509302(-;AGGGATGAAATCAGGAGCCA)
Make rs397509302(AGGGATGAAATCAGGAGCCA;AGGGATGAAATCAGGAGCCA)
ReferenceGRCh38 38.1/141
Chromosome17
Position43095891
GeneBRCA1
is asnp
is mentioned by
dbSNPrs397509302
dbSNP (old)rs397509302
ClinGenrs397509302
ebirs397509302
HLIrs397509302
Exacrs397509302
Gnomadrs397509302
Varsomers397509302
Maprs397509302
PheGenIrs397509302
Biobankrs397509302
1000 genomesrs397509302
hgdprs397509302
ensemblrs397509302
gopubmedrs397509302
geneviewrs397509302
scholarrs397509302
googlers397509302
pharmgkbrs397509302
gwascentralrs397509302
openSNPrs397509302
23andMers397509302
23andMe allrs397509302
SNP Nexus

SNPshotrs397509302
SNPdbers397509302
MSV3drs397509302
GWAS Ctlgrs397509302
Max Magnitude0
ClinVar
Risk rs397509302(AGGGATGAAATCAGGAGCCA;AGGGATGAAATCAGGAGCCA)
Alt rs397509302(AGGGATGAAATCAGGAGCCA;AGGGATGAAATCAGGAGCCA)
Reference Rs397509302(-;-)
Significance Untested
Disease Familial cancer of breast
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast
Reversed 1
HGVS NC_000017.10:g.41247908_41247909insTGGCTCCTGATTTCATCCCT
CLNSRC ClinVar
CLNACC RCV000049074.2,