Have questions? Visit https://www.reddit.com/r/SNPedia

rs397509186

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(AAACATCTTACTTGCCAAGG;AAACATCTTACTTGCCAAGG) 0 common in clinvar
Make rs397509186(-;-)
Make rs397509186(-;AAACATCTTACTTGCCAAGG)
ReferenceGRCh38 38.1/141
Chromosome17
Position43074341
GeneBRCA1
is asnp
is mentioned by
dbSNPrs397509186
dbSNP (old)rs397509186
ClinGenrs397509186
ebirs397509186
HLIrs397509186
Exacrs397509186
Varsomers397509186
Maprs397509186
PheGenIrs397509186
Biobankrs397509186
1000 genomesrs397509186
hgdprs397509186
ensemblrs397509186
gopubmedrs397509186
geneviewrs397509186
scholarrs397509186
googlers397509186
pharmgkbrs397509186
gwascentralrs397509186
openSNPrs397509186
23andMers397509186
23andMe allrs397509186
SNP Nexus

SNPshotrs397509186
SNPdbers397509186
MSV3drs397509186
GWAS Ctlgrs397509186
Max Magnitude0
ClinVar
Risk rs397509186(-;-)
Alt rs397509186(-;-)
Reference Rs397509186(AAACATCTTACTTGCCAAGG;AAACATCTTACTTGCCAAGG)
Significance Untested
Disease Familial cancer of breast
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast
Reversed 1
HGVS NC_000017.10:g.41226358_41226377del20
CLNSRC ClinVar
CLNACC RCV000048617.2,