Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508795

From SNPedia

ClinVar
Risk rs397508795(TCTTCCTCAGATTCATTGTGATTACCTCA;TCTTCCTCAGATTCATTGTGATTACCTCA)
Alt rs397508795(TCTTCCTCAGATTCATTGTGATTACCTCA;TCTTCCTCAGATTCATTGTGATTACCTCA)
Reference Rs397508795(C;C)
Significance Untested
Disease Cystic fibrosis
Variation info
Gene CFTR
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117176633delCinsTCTTCCTCAGATTCATTGTGATTACCTCA
CLNSRC ClinVar
CLNACC RCV000047253.2,