Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508474

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(ATTGTGATTGGAGCTATAGCAG;ATTGTGATTGGAGCTATAGCAG) 0 common in clinvar
Make rs397508474(-;-)
Make rs397508474(-;ATTGTGATTGGAGCTATAGCAG)
ReferenceGRCh38 38.1/141
Chromosome7
Position117610528
GeneCFTR
is asnp
is mentioned by
dbSNPrs397508474
dbSNP (old)rs397508474
ClinGenrs397508474
ebirs397508474
HLIrs397508474
Exacrs397508474
Gnomadrs397508474
Varsomers397508474
Maprs397508474
PheGenIrs397508474
Biobankrs397508474
1000 genomesrs397508474
hgdprs397508474
ensemblrs397508474
gopubmedrs397508474
geneviewrs397508474
scholarrs397508474
googlers397508474
pharmgkbrs397508474
gwascentralrs397508474
openSNPrs397508474
23andMers397508474
23andMe allrs397508474
SNP Nexus

SNPshotrs397508474
SNPdbers397508474
MSV3drs397508474
GWAS Ctlgrs397508474
Max Magnitude0
ClinVar
Risk rs397508474(-;-)
Alt rs397508474(-;-)
Reference Rs397508474(ATTGTGATTGGAGCTATAGCAG;ATTGTGATTGGAGCTATAGCAG)
Significance Untested
Disease Cystic fibrosis
Variation info
Gene CFTR
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117250582_117250603del22
CLNSRC ClinVar
CLNACC RCV000046748.2,