Have questions? Visit https://www.reddit.com/r/SNPedia

rs397507180

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCA) 6 BRCA1 variant considered pathogenic for breast cancer
(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCA;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCA) 0 common in clinvar


Make rs397507180(-;-)
ReferenceGRCh38 38.1/141
Chromosome17
Position43094316
GeneBRCA1
is asnp
is mentioned by
dbSNPrs397507180
dbSNP (old)rs397507180
ClinGenrs397507180
ebirs397507180
HLIrs397507180
Exacrs397507180
Gnomadrs397507180
Varsomers397507180
Maprs397507180
PheGenIrs397507180
Biobankrs397507180
1000 genomesrs397507180
hgdprs397507180
ensemblrs397507180
gopubmedrs397507180
geneviewrs397507180
scholarrs397507180
googlers397507180
pharmgkbrs397507180
gwascentralrs397507180
openSNPrs397507180
23andMers397507180
23andMe allrs397507180
SNP Nexus

SNPshotrs397507180
SNPdbers397507180
MSV3drs397507180
GWAS Ctlgrs397507180
Max Magnitude6

BRCA1, c.1175_1215del41 (p.Leu392Glnfs)

ClinVar
Risk rs397507180(-;-)
Alt rs397507180(-;-)
Reference Rs397507180(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCA;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCA)
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41246333_41246373del41
CLNSRC ClinVar
CLNACC RCV000030975.3,