Have questions? Visit https://www.reddit.com/r/SNPedia

rs386134216

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(AGGGACCATGTGCATCTATGG;AGGGACCATGTGCATCTATGG) 0 common in clinvar
Make rs386134216(-;-)
Make rs386134216(-;AGGGACCATGTGCATCTATGG)
ReferenceGRCh38 38.1/141
Chromosome5
Position132390907
GeneSLC22A5
is asnp
is mentioned by
dbSNPrs386134216
dbSNP (old)rs386134216
ClinGenrs386134216
ebirs386134216
HLIrs386134216
Exacrs386134216
Gnomadrs386134216
Varsomers386134216
Maprs386134216
PheGenIrs386134216
Biobankrs386134216
1000 genomesrs386134216
hgdprs386134216
ensemblrs386134216
gopubmedrs386134216
geneviewrs386134216
scholarrs386134216
googlers386134216
pharmgkbrs386134216
gwascentralrs386134216
openSNPrs386134216
23andMers386134216
23andMe allrs386134216
SNP Nexus

SNPshotrs386134216
SNPdbers386134216
MSV3drs386134216
GWAS Ctlgrs386134216
Max Magnitude0
ClinVar
Risk rs386134216(-;-)
Alt rs386134216(-;-)
Reference Rs386134216(AGGGACCATGTGCATCTATGG;AGGGACCATGTGCATCTATGG)
Significance Untested
Disease Renal carnitine transport defect
Variation info
Gene SLC22A5
CLNDBN Renal carnitine transport defect
Reversed 0
HGVS NC_000005.9:g.131726599_131726619del21
CLNSRC ClinVar
CLNACC RCV000022369.2,


[PMID 15714519] Validation of dye-binding/high-resolution thermal denaturation for the identification of mutations in the SLC22A5 gene.