Have questions? Visit https://www.reddit.com/r/SNPedia

rs377767365

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(GGCCCAGGATCAGTAGGTGGAATAG;GGCCCAGGATCAGTAGGTGGAATAG) 0 common in clinvar
Make rs377767365(-;-)
Make rs377767365(-;GGCCCAGGATCAGTAGGTGGAATAG)
ReferenceGRCh38 38.1/141
Chromosome18
Position51076740
GeneSMAD4
is asnp
is mentioned by
dbSNPrs377767365
dbSNP (old)rs377767365
ClinGenrs377767365
ebirs377767365
HLIrs377767365
Exacrs377767365
Gnomadrs377767365
Varsomers377767365
Maprs377767365
PheGenIrs377767365
Biobankrs377767365
1000 genomesrs377767365
hgdprs377767365
ensemblrs377767365
gopubmedrs377767365
geneviewrs377767365
scholarrs377767365
googlers377767365
pharmgkbrs377767365
gwascentralrs377767365
openSNPrs377767365
23andMers377767365
23andMe allrs377767365
SNP Nexus

SNPshotrs377767365
SNPdbers377767365
MSV3drs377767365
GWAS Ctlgrs377767365
Max Magnitude0
ClinVar
Risk rs377767365(-;-)
Alt rs377767365(-;-)
Reference Rs377767365(GGCCCAGGATCAGTAGGTGGAATAG;GGCCCAGGATCAGTAGGTGGAATAG)
Significance Pathogenic
Disease Juvenile polyposis syndrome
Variation info
Gene SMAD4
CLNDBN Juvenile polyposis syndrome
Reversed 0
HGVS NC_000018.9:g.48603110_48603134del25
CLNSRC ClinVar
CLNACC RCV000021736.1,


[PMID 18178612] Large genomic deletions of SMAD4, BMPR1A and PTEN in juvenile polyposis.