Have questions? Visit https://www.reddit.com/r/SNPedia

rs377767362

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(AGCAGCAGGCGGCTACTGCACAA;AGCAGCAGGCGGCTACTGCACAA) 0 common in clinvar
Make rs377767362(-;-)
Make rs377767362(-;AGCAGCAGGCGGCTACTGCACAA)
ReferenceGRCh38 38.1/141
Chromosome18
Position51076672
GeneSMAD4
is asnp
is mentioned by
dbSNPrs377767362
dbSNP (old)rs377767362
ClinGenrs377767362
ebirs377767362
HLIrs377767362
Exacrs377767362
Gnomadrs377767362
Varsomers377767362
Maprs377767362
PheGenIrs377767362
Biobankrs377767362
1000 genomesrs377767362
hgdprs377767362
ensemblrs377767362
gopubmedrs377767362
geneviewrs377767362
scholarrs377767362
googlers377767362
pharmgkbrs377767362
gwascentralrs377767362
openSNPrs377767362
23andMers377767362
23andMe allrs377767362
SNP Nexus

SNPshotrs377767362
SNPdbers377767362
MSV3drs377767362
GWAS Ctlgrs377767362
Max Magnitude0
ClinVar
Risk rs377767362(-;-)
Alt rs377767362(-;-)
Reference Rs377767362(AGCAGCAGGCGGCTACTGCACAA;AGCAGCAGGCGGCTACTGCACAA)
Significance Pathogenic
Disease Juvenile polyposis syndrome
Variation info
Gene SMAD4
CLNDBN Juvenile polyposis syndrome
Reversed 0
HGVS NC_000018.9:g.48603042_48603064del23
CLNSRC ClinVar
CLNACC RCV000021733.1,


[PMID 15235019OA-icon.png] The prevalence of MADH4 and BMPR1A mutations in juvenile polyposis and absence of BMPR2, BMPR1B, and ACVR1 mutations.