Have questions? Visit https://www.reddit.com/r/SNPedia

rs312262714

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GGCATTGCAAAAGCTCATTGA;GGCATTGCAAAAGCTCATTGA) 0 common in clinvar
Make rs312262714(-;-)
Make rs312262714(-;GGCATTGCAAAAGCTCATTGA)
ReferenceGRCh38 38.1/141
Chromosome15
Position44660446
GeneSPG11
is asnp
is mentioned by
dbSNPrs312262714
dbSNP (old)rs312262714
ClinGenrs312262714
ebirs312262714
HLIrs312262714
Exacrs312262714
Gnomadrs312262714
Varsomers312262714
Maprs312262714
PheGenIrs312262714
Biobankrs312262714
1000 genomesrs312262714
hgdprs312262714
ensemblrs312262714
gopubmedrs312262714
geneviewrs312262714
scholarrs312262714
googlers312262714
pharmgkbrs312262714
gwascentralrs312262714
openSNPrs312262714
23andMers312262714
23andMe allrs312262714
SNP Nexus

SNPshotrs312262714
SNPdbers312262714
MSV3drs312262714
GWAS Ctlgrs312262714
Max Magnitude0
ClinVar
Risk rs312262714(-;-)
Alt rs312262714(-;-)
Reference Rs312262714(GGCATTGCAAAAGCTCATTGA;GGCATTGCAAAAGCTCATTGA)
Significance Pathogenic
Disease Spastic paraplegia 11
Variation info
Gene SPG11
CLNDBN Spastic paraplegia 11, autosomal recessive
Reversed 1
HGVS NC_000015.9:g.44952644_44952664del21
CLNSRC ClinVar GeneReviews
CLNACC RCV000034215.2,


[PMID 19105190] Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion.