Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;-) normal risk
(-;GATGAGGAAACTAACTCTCAGTGGTGTTTA) 1.57x increased risk for oral cancer
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
1000 genomesrs28360071
23andMe allrs28360071
SNP Nexus

GWAS Ctlgrs28360071
Max Magnitude
rs28360071 is an insertion/deletion SNP in the DNA repair XRCC4 gene.

Individuals in a Taiwanese Chinese population heterozygous for this SNP rs28360071 were at increased risk (odd ratio 1.57, CI: 1.12-2.21) of oral cancer compared to those homozygous for the insertion form of this SNP. The deletion allele was also associated with 3x higher risk than the insertion allele among smokers and betel quid chewer groups.[PMID 18164646]

[PMID 19443403] Significant Association of an XRCC4 Single Nucleotide Polymorphism with Bladder Cancer Susceptibility in Taiwan; note: no association seen for this SNP

[PMID 19729825] Lung cancer susceptibility and genetic polymorphism of DNA repair gene XRCC4 in Taiwan

[PMID 20332465] Significant association of XRCC4 single nucleotide polymorphisms with childhood leukemia in Taiwan

[PMID 20683005] Colorectal Cancer and Genetic Polymorphism of DNA Double-strand Break Repair Gene XRCC4 in Taiwan

[PMID 21717429OA-icon.png] Genetic variants of the nonhomologous end joining gene LIG4 and severe radiation pneumonitis in nonsmall cell lung cancer patients treated with definitive radiotherapy [PMID 17987338] A novel single nucleotide polymorphism in XRCC4 gene is associated with gastric cancer susceptibility in Taiwan.

[PMID 21506695] Do polymorphisms in XRCC4 influence prostate cancer susceptibility in North Indian population?