Have questions? Visit https://www.reddit.com/r/SNPedia

rs281874744

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(ATTATGTTCCTTCTCCTTTTCC;ATTATGTTCCTTCTCCTTTTCC) 0 common in clinvar
Make rs281874744(ATTATGTTCCTTCTCCTTTTCC;CA)
Make rs281874744(CA;CA)
ReferenceGRCh38 38.1/141
ChromosomeX
Position108694777
GeneCOL4A5
is asnp
is mentioned by
dbSNPrs281874744
dbSNP (old)rs281874744
ClinGenrs281874744
ebirs281874744
HLIrs281874744
Exacrs281874744
Gnomadrs281874744
Varsomers281874744
Maprs281874744
PheGenIrs281874744
Biobankrs281874744
1000 genomesrs281874744
hgdprs281874744
ensemblrs281874744
gopubmedrs281874744
geneviewrs281874744
scholarrs281874744
googlers281874744
pharmgkbrs281874744
gwascentralrs281874744
openSNPrs281874744
23andMers281874744
23andMe allrs281874744
SNP Nexus

SNPshotrs281874744
SNPdbers281874744
MSV3drs281874744
GWAS Ctlgrs281874744
Max Magnitude0
ClinVar
Risk rs281874744(CA;CA)
Alt rs281874744(CA;CA)
Reference Rs281874744(ATTATGTTCCTTCTCCTTTTCC;ATTATGTTCCTTCTCCTTTTCC)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107938007_107938028del22insCA
CLNSRC ClinVar
CLNACC RCV000021637.1,


[PMID 20378821OA-icon.png] Genotype-phenotype correlation in X-linked Alport syndrome.