Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608637

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(AGAGTTAGCTGACTTTACACGGAG;AGAGTTAGCTGACTTTACACGGAG) 0 common in clinvar
Make rs267608637(-;-)
Make rs267608637(-;AGAGTTAGCTGACTTTACACGGAG)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position154030355
GeneMECP2
is asnp
is mentioned by
dbSNPrs267608637
dbSNP (old)rs267608637
ClinGenrs267608637
ebirs267608637
HLIrs267608637
Exacrs267608637
Gnomadrs267608637
Varsomers267608637
Maprs267608637
PheGenIrs267608637
Biobankrs267608637
1000 genomesrs267608637
hgdprs267608637
ensemblrs267608637
gopubmedrs267608637
geneviewrs267608637
scholarrs267608637
googlers267608637
pharmgkbrs267608637
gwascentralrs267608637
openSNPrs267608637
23andMers267608637
23andMe allrs267608637
SNP Nexus

SNPshotrs267608637
SNPdbers267608637
MSV3drs267608637
GWAS Ctlgrs267608637
Max Magnitude0
ClinVar
Risk rs267608637(-;-)
Alt rs267608637(-;-)
Reference Rs267608637(AGAGTTAGCTGACTTTACACGGAG;AGAGTTAGCTGACTTTACACGGAG)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153295806_153295829del24
CLNSRC
CLNACC RCV000133012.2,