Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608599

From SNPedia

ClinVar
Risk
Alt
Reference Rs267608599(CACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC;CACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC)
Significance Pathogenic
Disease not provided Rett syndrome
Variation info
Gene MECP2
CLNDBN not provided Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296082_153296116del35
CLNSRC
CLNACC RCV000132906.1, RCV000132928.2,