Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608578

From SNPedia

ClinVar
Risk rs267608578(-;-)
Alt rs267608578(-;-)
Reference Rs267608578(CCCTGCCCCCACCTCCACCTGAGCCCGAGAGC;CCCTGCCCCCACCTCCACCTGAGCCCGAGAGC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296094_153296125del32
CLNSRC
CLNACC RCV000132882.2,