Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608567

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CACCACCATCACCACCACTC;CACCACCATCACCACCACTC) 0 common in clinvar
Make rs267608567(-;-)
Make rs267608567(-;CACCACCATCACCACCACTC)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position154030710
GeneMECP2
is asnp
is mentioned by
dbSNPrs267608567
dbSNP (old)rs267608567
ClinGenrs267608567
ebirs267608567
HLIrs267608567
Exacrs267608567
Gnomadrs267608567
Varsomers267608567
Maprs267608567
PheGenIrs267608567
Biobankrs267608567
1000 genomesrs267608567
hgdprs267608567
ensemblrs267608567
gopubmedrs267608567
geneviewrs267608567
scholarrs267608567
googlers267608567
pharmgkbrs267608567
gwascentralrs267608567
openSNPrs267608567
23andMers267608567
23andMe allrs267608567
SNP Nexus

SNPshotrs267608567
SNPdbers267608567
MSV3drs267608567
GWAS Ctlgrs267608567
Max Magnitude0
ClinVar
Risk rs267608567(-;-)
Alt rs267608567(-;-)
Reference Rs267608567(CACCACCATCACCACCACTC;CACCACCATCACCACCACTC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296161_153296180del20
CLNSRC
CLNACC RCV000132854.2,