Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608540

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GATCTGTGCAGGAGACCGTACT;GATCTGTGCAGGAGACCGTACT) 0 common in clinvar
Make rs267608540(-;-)
Make rs267608540(-;GATCTGTGCAGGAGACCGTACT)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position154030926
GeneMECP2
is asnp
is mentioned by
dbSNPrs267608540
dbSNP (old)rs267608540
ClinGenrs267608540
ebirs267608540
HLIrs267608540
Exacrs267608540
Gnomadrs267608540
Varsomers267608540
Maprs267608540
PheGenIrs267608540
Biobankrs267608540
1000 genomesrs267608540
hgdprs267608540
ensemblrs267608540
gopubmedrs267608540
geneviewrs267608540
scholarrs267608540
googlers267608540
pharmgkbrs267608540
gwascentralrs267608540
openSNPrs267608540
23andMers267608540
23andMe allrs267608540
SNP Nexus

SNPshotrs267608540
SNPdbers267608540
MSV3drs267608540
GWAS Ctlgrs267608540
Max Magnitude0
ClinVar
Risk rs267608540(-;-)
Alt rs267608540(-;-)
Reference Rs267608540(GATCTGTGCAGGAGACCGTACT;GATCTGTGCAGGAGACCGTACT)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296377_153296398del22
CLNSRC
CLNACC RCV000133267.2,