Have questions? Visit https://www.reddit.com/r/SNPedia

rs267607746

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(GCAAGTTACTCAGATGGAAAA;GCAAGTTACTCAGATGGAAAA) 0 common in clinvar
Make rs267607746(GCAAGTTACTCAGATGGAAAA;T)
Make rs267607746(T;T)
ReferenceGRCh38 38.1/141
Chromosome3
Position37006992
GeneMLH1
is asnp
is mentioned by
dbSNPrs267607746
dbSNP (old)rs267607746
ClinGenrs267607746
ebirs267607746
HLIrs267607746
Exacrs267607746
Gnomadrs267607746
Varsomers267607746
Maprs267607746
PheGenIrs267607746
Biobankrs267607746
1000 genomesrs267607746
hgdprs267607746
ensemblrs267607746
gopubmedrs267607746
geneviewrs267607746
scholarrs267607746
googlers267607746
pharmgkbrs267607746
gwascentralrs267607746
openSNPrs267607746
23andMers267607746
23andMe allrs267607746
SNP Nexus

SNPshotrs267607746
SNPdbers267607746
MSV3drs267607746
GWAS Ctlgrs267607746
Max Magnitude0
ClinVar
Risk rs267607746(T;T)
Alt rs267607746(T;T)
Reference Rs267607746(GCAAGTTACTCAGATGGAAAA;GCAAGTTACTCAGATGGAAAA)
Significance Pathogenic
Disease Lynch syndrome
Variation info
Gene MLH1
CLNDBN Lynch syndrome
Reversed 0
HGVS NC_000003.11:g.37048483_37048503del21insT
CLNSRC International Society for Gastrointestinal Hereditary Tumours
CLNACC RCV000075688.2,