Have questions? Visit https://www.reddit.com/r/SNPedia

rs267606578

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs267606578(-;TTCAAGCGGGGCAAGGCCCAC)
Make rs267606578(TTCAAGCGGGGCAAGGCCCAC;TTCAAGCGGGGCAAGGCCCAC)
ReferenceGRCh38 38.1/141
Chromosome11
Position67490825
GeneAIP
is asnp
is mentioned by
dbSNPrs267606578
dbSNP (old)rs267606578
ClinGenrs267606578
ebirs267606578
HLIrs267606578
Exacrs267606578
Varsomers267606578
Maprs267606578
PheGenIrs267606578
Biobankrs267606578
1000 genomesrs267606578
hgdprs267606578
ensemblrs267606578
gopubmedrs267606578
geneviewrs267606578
scholarrs267606578
googlers267606578
pharmgkbrs267606578
gwascentralrs267606578
openSNPrs267606578
23andMers267606578
23andMe allrs267606578
SNP Nexus

SNPshotrs267606578
SNPdbers267606578
MSV3drs267606578
GWAS Ctlgrs267606578
Max Magnitude0
ClinVar
Risk rs267606578(ACTTCAAGCGGGGCAAGGCCC;ACTTCAAGCGGGGCAAGGCCC)
Alt rs267606578(ACTTCAAGCGGGGCAAGGCCC;ACTTCAAGCGGGGCAAGGCCC)
Reference Rs267606578(-;-)
Significance Pathogenic
Disease Somatotroph adenoma
Variation info
Gene AIP
CLNDBN Somatotroph adenoma
Reversed 0
HGVS NC_000011.9:g.67258276_67258296dup21
CLNSRC ClinVar GeneReviews
CLNACC RCV000034107.2,