Have questions? Visit https://www.reddit.com/r/SNPedia

rs199475570

From SNPedia

ClinVar
Risk
Alt
Reference
Property "RefGeno" (as page type) with input value "rs199475570(AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG;AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG)" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
rs199475570(AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG;AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG)
Significance Pathogenic
Disease Phenylketonuria not provided
Variation info
Gene PAH
CLNDBN Phenylketonuria not provided
Reversed 1
HGVS NC_000012.12:g.102894735_102894918del184
CLNSRC OMIM Allelic Variant
CLNACC RCV000000615.3, RCV000088856.1,