Have questions? Visit https://www.reddit.com/r/SNPedia

rs199474368

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs199474368(-;TCATCGCCGTGGGCAGCCCCGCT)
Make rs199474368(TCATCGCCGTGGGCAGCCCCGCT;TCATCGCCGTGGGCAGCCCCGCT)
ReferenceGRCh37.p5 37.3/137
Chromosome6
Position29910596
GeneHLA-A
is asnp
is mentioned by
dbSNPrs199474368
dbSNP (old)rs199474368
ClinGenrs199474368
ebirs199474368
HLIrs199474368
Exacrs199474368
Gnomadrs199474368
Varsomers199474368
Maprs199474368
PheGenIrs199474368
Biobankrs199474368
1000 genomesrs199474368
hgdprs199474368
ensemblrs199474368
gopubmedrs199474368
geneviewrs199474368
scholarrs199474368
googlers199474368
pharmgkbrs199474368
gwascentralrs199474368
openSNPrs199474368
23andMers199474368
23andMe allrs199474368
SNP Nexus

SNPshotrs199474368
SNPdbers199474368
MSV3drs199474368
GWAS Ctlgrs199474368
StatusDeleted
Max Magnitude0
ClinVar
Risk rs199474368(TCATCGCCGTGGGCAGCCCCGCT;TCATCGCCGTGGGCAGCCCCGCT)
Alt rs199474368(TCATCGCCGTGGGCAGCCCCGCT;TCATCGCCGTGGGCAGCCCCGCT)
Reference Rs199474368(;)
Significance Histocompatibility
Disease
Variation info
Gene
CLNDBN
Reversed 0
HGVS NC_000006.11:g.29910596_29910597insTCATCGCCGTGGGCAGCCCCGCT
CLNSRC
CLNACC