Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922856

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(CAGCAGTGACGCGCGCTGGG;CAGCAGTGACGCGCGCTGGG) 0 common in clinvar
(CTGGGCAGCAGTGACGCGCG;CTGGGCAGCAGTGACGCGCG) 0 common in clinvar
Make rs193922856(-;-)
Make rs193922856(-;CAGCAGTGACGCGCGCTGGG)
ReferenceGRCh38 38.1/141
Chromosome19
Position38565347
GeneRYR1
is asnp
is mentioned by
dbSNPrs193922856
dbSNP (old)rs193922856
ClinGenrs193922856
ebirs193922856
HLIrs193922856
Exacrs193922856
Varsomers193922856
Maprs193922856
PheGenIrs193922856
Biobankrs193922856
1000 genomesrs193922856
hgdprs193922856
ensemblrs193922856
gopubmedrs193922856
geneviewrs193922856
scholarrs193922856
googlers193922856
pharmgkbrs193922856
gwascentralrs193922856
openSNPrs193922856
23andMers193922856
23andMe allrs193922856
SNP Nexus

SNPshotrs193922856
SNPdbers193922856
MSV3drs193922856
GWAS Ctlgrs193922856
Max Magnitude0
ClinVar
Risk rs193922856(-;-)
Alt rs193922856(-;-)
Reference Rs193922856(CTGGGCAGCAGTGACGCGCG;CTGGGCAGCAGTGACGCGCG)
Significance Pathogenic
Disease Neuromuscular disease not provided
Variation info
Gene RYR1
CLNDBN Neuromuscular disease, congenital, with uniform type 1 fiber not provided
Reversed 0
HGVS NC_000019.9:g.39055987_39056006del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000013870.24, RCV000119472.1,


[PMID 17538032] Congenital neuromuscular disease with uniform type 1 fiber and RYR1 mutation.