Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922563

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TGGTCTATTTTCCCACCCTTAGGCT;TGGTCTATTTTCCCACCCTTAGGCT) 0 common in clinvar
Make rs193922563(-;-)
Make rs193922563(-;TGGTCTATTTTCCCACCCTTAGGCT)
ReferenceGRCh38 38.1/141
Chromosome11
Position5226797
GeneHBB
is asnp
is mentioned by
dbSNPrs193922563
dbSNP (old)rs193922563
ClinGenrs193922563
ebirs193922563
HLIrs193922563
Exacrs193922563
Varsomers193922563
Maprs193922563
PheGenIrs193922563
Biobankrs193922563
1000 genomesrs193922563
hgdprs193922563
ensemblrs193922563
gopubmedrs193922563
geneviewrs193922563
scholarrs193922563
googlers193922563
pharmgkbrs193922563
gwascentralrs193922563
openSNPrs193922563
23andMers193922563
23andMe allrs193922563
SNP Nexus

SNPshotrs193922563
SNPdbers193922563
MSV3drs193922563
GWAS Ctlgrs193922563
Max Magnitude0
ClinVar
Risk rs193922563(-;-)
Alt rs193922563(-;-)
Reference Rs193922563(TGGTCTATTTTCCCACCCTTAGGCT;TGGTCTATTTTCCCACCCTTAGGCT)
Significance Pathogenic
Disease beta^0^ Thalassemia Beta Thalassemia
Variation info
Gene HBB
CLNDBN beta^0^ Thalassemia beta Thalassemia
Reversed 1
HGVS NC_000011.9:g.5248027_5248051del25
CLNSRC HBVAR OMIM Allelic Variant
CLNACC RCV000016700.26, RCV000030009.1,